Cross Sections/Avatar Anatomy
Replies
I have no idea how that can function without, yunno, not functioning. Nice anyway Kurtzmans. But here's mine:
 It's not readable, though. No amount of fumbling with the size could make it readable. I don't even know if sending it personally will fix it. Curse you Vista /:| If needed I can provide a transcript.
Probably will need a transcript. Hang on...
Clockwise starting from the orange part in the left panel: "Transplanted headpiece from Garfield", nose is "Compact but hard to draw nostril", next is "Pikachu ear. Result of interrupted evoloution." Left eye reads "tears come in two flavours: Regular and Kawaii", Left cheek reads "Pikachu electric sac. Result of interrupted evoloution", disappointed mouth reads "Ignore this. He's perfectly happy.", Tail reads "Tail/Butt wrench", right foot reads "Three clawed paw for gripping", black neck thing reads "scarf", right arm reads "Paw incapable of flipping you the bird", right cheek reads "Pichu's regular electric sac", right eye reads "Beady eyes, silently judging you", (not visible) Garfield-esque whiskers on Garfield fragment reads "Poorly drawn whiskers". Caption reads: "THE UNNAMED GARFIELD FAN HAS A MESSED UP EXTERIOR." Deep breath Second panel, anticlockwise from caption to the right of diagram: "AND WHAT THE FRAXURE IS UP WITH HIS BRAIN?" Right half of diagram labeled "IQ Lobe", chunk in center labelled, "This is why he likes what he does" top bit labeled "Soda stain", left part reads "Emotional Cortex", a small circled part is labelled "Depression Gland", Wedge-shaped chunk reads "The DNA in this part is just CATCATCATCATCATCATCATCAT" and the mark in the corner of the diagram is a crude stickman drawing of Ask Ketchum saying "Help", labelled "Oh dear... How did he get in there?" Third frame, anticlockwise from first caption in top left, which reads "As for the body analysis..." then "Coin slot" which leads to "Probably the stomach" which leads to "Sub-sewer output" which is all joined to "Intestines". GASP The left bar reads "Arm bone and joint", the black line reads "Pepsi receptacle", the multicolour circle reads "Not sure if USA or Pepsi", the yellow bit reads "Secondary electric storage", which connects to two wires running up to the head area... aaaand the caption in the top right reads "THAT'S IT, I'M OUTTA HERE".
I'm starting to hate this laptop.
ahah, nice idea, i wanted to do something like this, but yours is better!
(sorry for picturezilla :/ )
Red arrows :
- small one : 1 meter
- big one : 3 meters
Green : extensible jaw and different teeth
Red/pink : changing face (it can have YOUR face hehe)
Purple : Glowing or not punctured eyes
Blue : top, hair in feminine version
Yellow : muscles, they can change or transform in feminine version
Dark green : bones
Dark blue : organ that create a powerful acid, that's the weird black thingy coming form its eyes and sometimes its mouth
Brown : Claws, sometimes, they can transform into scissors
Aqua : legs can disappear, that gives to my avatar a ghostly appearance.
Grey around all of it : darkness, it always have darkness around it, and can create some if it needs.
Special power : it can fade away, become your worst nightmare, disguise and become a sexy woman that is completely useless.
Yup seems legit
Since my character's human with no physical deformations, I'm just going leave this here:
No, the cuts are external and very shallow. Also, the rest of the blood you see is caked on, as the avatar was in a battle previously. So, some of the blood is his and some of it isn't. Due to the cuts being relatively minor and causing no/little damage to the character's interior. If the entire extent of the damage would be non-existant/relatively minor, there would be no reason to create an anatomy diagram, as his body is pretty much the exact same as a fit human's would be.
Just a random idea I thought up--- make a cross-section anatomy chart of your avatar.